Art

Item Description

ARTIST:    Hafid Mourbat
TITLE:       Empreinte Digitale
MEDIUM:  Print with letterpress type, 16” x 20”, unframed

This original artwork was created for Art on Science: 26 études an internattional portfolio featuring pictures by artists and words by scientists. This written commentary is by Christine Keyser, Genetics Department at University of Life Sciences:
 
As a University Professor at the Faculty of Life Sciences of Strasbourg, I teach genetics to undergraduate and graduate students. At the same time, I conduct research on the genetic characterization of individuals from ancient funerary sites to better understand the history of past human populations.
 
I am also an expert in forensic science and assist judicial investigations to confront suspects or establish the identity of previously unidentified people. This field of research may seem rather far from art, but many artists have been able to draw inspiration from the genetic profiles established to characterize
an individual and to make them into unique original works.

I particularly liked the artistic work of Hafid Mourbat because it evokes fingerprints which have been used since the beginning of the 20th century in criminal sciences to create a file, then search for a suspect and identify them. We worked together to
emphasize the importance of genetics in forensic investigations over the last thirty years. In fact, genetic fingerprints make it possible to identify an individual from deoxyribonucleic acid (DNA) contained in the cells of the human body; they are an alternative or indispensable complement for investigators when the digital traces are absent from a crime scene or unusable.

The colored plate of Hafid Mourbat symbolizes for me thevariability or genetic polymorphism that exists between individuals and that makes it possible to distinguish them from one another. In fact, each individual is unique, and the technique of genetic fingerprints makes it possible to reveal this uniqueness of the individual and to use it in a judicial context. The second print by Hafid MOURBAT represents, in my opinion, an original fingerprint since it consists of a sequence of characters (and not crests and dermal folds), into which have slipped DNA sequences. Indeed, the genetic information that characterizes each individual is encoded in DNA, thanks to 4 bases which are Adenine, Thymine, Cytosine and Guanine (symbolized by the letters A, T, G and C). The sequence of these 4 bases (or letters) determines a DNA sequence that can be specific to each individual. The work of Hafid Mourbat houses the two small sequences “ACGTCTTGCAATGATTACCTAGGCAAAC” and “CCTCACTTGTAT” as a nod to the fingerprint.

In addition to being highly significant in my view, these two works are both contemporary and timeless as they both symbolize the imprint that Man leaves upon History.

Item Special Note

Free domestic shipping.

All artworks are 16” x 20”, unframed and will be shipped with a printed copy of the scientist’s text.

For further information about the portfolio, please visit our Art on Science: 26 études website: http://AS26project.com